RNAi Oligo Design Tool Readme

   This tool is developed to help scientists to design gene-specific oligos 
for targeted gene slilencing in mammalian cells based on DNA vector transformation
technolofy. A sample DNA sequence should be prepared in  this format:
>sequence 1 ID
atcggtgcttcggcttatatggcgatt
gatggtctggaatagattaagatatca
>sequence 2 ID
ggatgagtacacagatagagatcacag
atcggtgcttcggcttatatggcgatt
gatggtctggaatagattaagatatca

Multiple sequences can be processed but the user shouldn't try to crash the service
with large amount data.

The oligos are selected by the following criterias:

1. Pick a substring from the input sequence that begin with two "G"s:
   5' -GGx, xxx,xxx,xxx,xxx,xxx,x 
2. Check if this substring contain EcoRI restriction site (cloning site);
3. Check if this substring unique in human cDNA database;
4. if both step 2 and step 3 are OK, attach "TTC AAG AGA" to the substring;
5. Attach the reverse combinated sequence of the original substring "xxx xxx xxx xxx xxx xxC C";
6. Attach "C TTT TTG" to the end of the forward oligo;
7. Make a backward oligo, attach "TTAA" to the end.
    
If you input an oligo of 19 or 20 nt, there will be no validation.

Here is the generic output oligo: 
5'- 19-20 nt, TTC AAG AGA- 19-20nt-TTT TTG-3'
3'- 19-20 nt, AAG TTC TCT -19-20nt-AAA AACTTAA-5'

Reference:
Sui G, Soohoo C, Affar el B, Gay F, Shi Y, Forrester WC, Shi Y. :
A DNA vector-based RNAi technology to suppress gene expression in mammalian cells.
Proc Natl Acad Sci U S A. 2002 Apr 16;99(8):5515-20.

Yu JY, DeRuiter SL, Turner DL.:
RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells.
Proc Natl Acad Sci U S A. 2002 Apr 30;99(9):6047-52.

Hutvagner G, Zamore PD.:
RNAi: nature abhors a double-strand.
Curr Opin Genet Dev. 2002 Apr;12(2):225-32.

Paddison PJ, Caudy AA, Bernstein E, Hannon GJ, Conklin DS.:
Short hairpin RNAs (shRNAs) induce sequence-specific silencing in mammalian cells.
Genes Dev. 2002 Apr 15;16(8):948-58.

Questions? Suggestions? email to gliu(at)genetics.wayne.edu.

Guozhen Liu, PhD
Center for Molecular Medicine and Genetics
Wayne State University School of Medicine
Detroit, MI 48201